Home 
Online Bioinformatic Tools
The terms bioinformatics and computational biology are often used interchangeably. However bioinformatics more properly refers to the creation and advancement of algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data. Computational biology, on the other hand, refers to hypothesis-driven investigation of a specific biological problem using computers, carried out with experimental or simulated data, with the primary goal of discovery and the advancement of biological knowledge. Put more simply, bioinformatics is concerned with the information while computational biology is concerned with the hypotheses.
Below you will find a number of online tools which you can use for different purposes as described below.
|
 |
Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.
|
|
|
Alignment of two DNA, RNA or protein sequences. The alignment method is the Smith-Waterman alignment method is used. More info in the script.
|
|
|
An electronic lab notebook (also known as electronic laboratory notebook, or ELN) is designed to replace paper laboratory notebooks. Lab notebooks in general are used by scientists and technicians to document research, experiments and procedures performed in a laboratory.
|
|
|
Simulation of PCR amplification. Allows one mismatch between primer and template
|
|
|
A "Laboratory Information Management System" (LIMS) is used in laboratories for the management of samples, laboratory users, instruments, standards and other laboratory functions such as invoicing, plate management, and work flow automation.
|
|
|
|
This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.
|
|
|
|
This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.
|
|
|
Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences.
|
|
|
Primer3 is a widely used program for designing PCR primers (PCR = "Polymerase Chain Reaction"). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers.
|
|
|
Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.
|
|
|
|
Search Pubmed/Genbank at the National Center for Biotechnology Information (NCBI)
|
|
|
Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).
|
|
|
|
The sequence is manipulated to get the reverse and complement strands.
|
|
|
The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.
|
|
|
